Matrices estratégicas de la Comisaría de Bienes Comunales de San Pedro Huamelula México

La comisaria de Bienes Comunales de San Pedro Huamelula es una institución de gobierno local para dirigir y controlar los derechos y obligaciones de los comuneros de las 14 comunidades pertenecientes a la comisaria, además que se encarga de resguardar los terrenos comunales de la región.

El análisis de los factores internos de la comisaria de bienes comunales de San Pedro Huamelula son importantes, ya que a partir de estos se puede analizar las amenazas, oportunidades, debilidades y fortalezas con las que se ven involucrados los de la  asamblea general de comuneros para generar su mercado y se puede llevar a cabo por medio de una matriz, ya que es una herramienta muy útil para el análisis, y  te permiten comparar todos aquellos elementos que puedan influir para la misma y al mismo tiempo te permite tomar estrategias de mejora.

En el siguiente trabajo se llevó acabo el análisis de la comisaria de bienes comunales de San Pedro Huamelula,  por medio de diferentes herramientas de análisis de factores internos y externos como lo son las matrices MEFI, MEFE, FODA, MCPE, estas herramientas nos permitirán ver las debilidades y fortalezas del sistema de la comisaria, en cuando a los factores internos y externos del desarrollo sustentable de la comunidad produciendo y comercializando.

Esta actividad permite fortalecer el trabajo de investigación para la comisaria de bienes comunales, para el desarrollo de proyectos de inversión,  permitiendo a su vez que los conocimientos adquiridos en la materia Seminario de Administración sean aplicados en el desarrollo de un proyecto integrador de consultoría.

Queda a disposición de críticas de mejora y sugerencias que puedan fortalecer el proyecto integrador del equipo por parte del catedrático y que nos permita una mejor comprensión en beneficio del mismo.

1.- Descripción de las matrices

A continuación se presenta información de la descripción general todas las matrices de insumo, matrices de adecuación y matriz de decisión.

1.1.- Matrices de insumo

La etapa uno llamada insumos resume la información básica que debe de tener para formular estrategias. El marco de la formulación está compuesta por una matriz MEFE, MEFI, MPC.

Matriz de evaluación de factores internas (MEFI)

Es un instrumento para formular estrategias, resume y evalúa las fuerzas y debilidades más importantes dentro de las áreas funcionales de un negocio y además ofrece una base para identificar y evaluar las relaciones entre dichas áreas.

  1. Identifica las fortalezas y debilidades DOFA más importantes de la organización y con ellas hacer una lista clara del procedimiento detallado.
  2. Asignar una ponderación que valla desde 0.0 (sin importancia) hasta 1.0 (de gran importancia) a cada factor, y tener en cuenta que la suma de dichas ponderaciones debe de sumar 1.0 esto para tener más certeza y ofrecer una cifra porcentual coherente
  3. Hacer una clasificación de uno a cuatro para indicar si dicha variable presenta: una debilidad importante (uno), Una debilidad menor (dos), Una fortaleza menor (tres), Una Fortaleza importante (4).
  4. Multiplicar la ponderación de cada factor por su clasificación para establecer el resultado ponderado para cada variable.
  5. Sumar los resultados ponderados para cada variable con el fin de determinar el resultado ponderado para una organización.
  6. Sin importar el número de factores por incluir el resultado total ponderado puede oscilar de un resultado bajo de 1.0 a otro alto de 4.0, siendo 2.5 el resultado promedio. Los resultados mayores de 2.5 indican una organización poseedora de una fuente de posición interna mientras que los menores de 2.5 muestran una organización con debilidades internas.

Matriz de evaluación de los factores externos (MEFE)

Matriz de evaluación de los factores externos (EFE) La matriz de evaluación de los factores externos (EFE) permite a los estrategas resumir y evaluar información económica, social, cultural, demográfica, ambiental, política, gubernamental, jurídica, tecnológica y competitiva.

Pasos para la construcción de una matriz EFE

  1. Hacer una lista de los factores críticos o determinantes para el éxito identificados en el proceso de la auditoría externa. Abarque un total de entre diez y veinte factores, incluyendo tanto oportunidades como amenazas que afectan a la empresa y su industria. En esta lista, primero anote las oportunidades y después las amenazas. Sea lo más específico posible, usando porcentajes, razones y cifras comparativas en la medida de lo posible.
  2. peso indica la importancia relativa que tiene ese factor para alcanzar el éxito en la industria de la empresa. Las oportunidades suelen tener pesos más altos que las amenazas, pero éstas, a su vez, pueden tener pesos altos si son especialmente graves o amenazadoras. Los pesos adecuados se pueden determinar comparando a los competidores que tienen éxito con los que no lo tienen o analizando el factor en grupo y llegando a un consenso. La suma de todos los pesos asignados a los factores debe sumar 1.0
  3. Asignar una calificación de 1 a 4 a cada uno de los factores determinantes para el éxito con el objeto de indicar si las estrategias presentes de la empresa están respondiendo con eficacia al factor, donde 4 = una respuesta superior, 3 = una respuesta superior a la media, 2 = una respuesta media y 1 = una respuesta mala. Las calificaciones se basan en la eficacia de las estrategias de la empresa. Así pues, las calificaciones se basan en la empresa, mientras que los pesos del paso 2 se basan en la industria.
  4. Multiplicar el peso de cada factor por su calificación para obtener una calificación ponderada.
  5. Sumar las calificaciones ponderadas de cada una de las variables para determinar el total ponderado de la organización.

Independientemente de la cantidad de oportunidades y amenazas clave incluidas en la matriz EFE, el total ponderado más alto que puede obtener la organización es 4.0 y el total ponderado más bajo posible es 1.0. El valor del promedio ponderado es 2.5. Un promedio ponderado de 4.0 indica que la organización está respondiendo de manera excelente a las oportunidades y amenazas existentes en su industria. En otras palabras, las estrategias de la empresa están aprovechando con eficacia las oportunidades existentes y minimizando los posibles efectos negativos de las amenazas externas. Un promedio ponderado de 1.0 indica que las estrategias de la empresa no están capitalizando las oportunidades ni evitando las amenazas externas.

Matriz de perfil competitivo (MPC)

Es una herramienta que identifica a los competidores más importantes de una empresa e informa sobre sus fortalezas y debilidades particulares. Los resultados de ellas deben usarse en forma cautelosa como ayuda en el proceso para la toma de decisiones.

Se caracteriza por Identificar a los principales competidores de la empresa, así como sus fuerzas y debilidades particulares, en relación con una muestra de la posición estratégica de la empresa.

Procedimiento

  1. Identificar los factores decisivos de éxito de la industria así como los competidores más representativos del mercado. Agregue a su empresa en la lista.
  2. Asignar una ponderación a cada factor ponderan té de éxito con el objeto de indicar la importancia relativa de ese factor para el éxito de la industria.

0.0 = SIN IMPORTANCIA    1.0 = MUY IMPORTANTE

Nota: La suma debe ser igual a 1.0

El total ponderado más alto indicara el competidor más amenazante mientras que el menor revelara quizás el más débil

Los totales ponderados pueden variar, entre 1.0 el más bajo a 4.0 el más alto.

1.2.- Matrices de Adecuación

Esta se concentra en generar estrategias alternativas viables alineando factores internos y externos clave. Las técnicas de la etapa dos incluyen  la matriz DOFA,PEYEA, BCG, IE y MGE.

Matriz de Fortalezas, Oportunidades, debilidades y Amenazas (FODA)

Es un instrumento viable para realizar análisis organizacional en relación con los factores que determinan el éxito en el cumplimiento de metas.

  • Fortalezas

Son las capacidades especiales con que cuenta la empresa, y que le permite tener una posición privilegiada frente a la competencia. Recursos que se controlan, capacidades y habilidades que se poseen, actividades que se desarrollan positivamente, etc.

  • Oportunidades

Son aquellos factores que resultan positivos, favorables, explotables, que se deben descubrir en el entorno en el que actúa la empresa, y que permiten obtener ventajas competitivas.

  • Debilidades

Son aquellos factores que provocan una posición desfavorable frente a la competencia, recursos de los que se carece, habilidades que no se poseen, actividades que no se desarrollan positivamente, etc.

  • Amenazas

Son aquellas situaciones que provienen del entorno y que pueden llegar a atentar incluso contra la permanencia de la organización.

Pasos para la construcción de la matriz FODA

  1. Hacer una lista de las fortalezas internas claves.
  2. Hacer una lista de las debilidades internas decisivas.
  3. Hacer una lista de las oportunidades externas importantes.
  4. Hacer una lista de las amenazas claves. v Pasos a seguir
  • A continuación, compare las fortalezas internas con las oportunidades externas y registre las estrategias FO resultantes en la casilla apropiada.
  • Compare las debilidades internas con las responsabilidades externas y registre  las estrategias DO resultantes.
  • Compare las fortalezas internas con las amenazas externas y registre las estrategias FA resultantes.
  • Compare las debilidades internas con las amenazas externas y registre las estrategias DA resultantes.

Matriz interna-externa (IE)

Esta técnica representa una herramienta para evaluar a una organización, tomando en cuenta sus Factores Internos (Fortalezas y Debilidades) y sus Factores Externos (Oportunidades y Amenazas), cuantificando un índice que se puede graficar y ubicar en uno de los 9 cuadrantes de dicha matriz.

Se llevan a cabo las Auditorías Internas y Externas, a fin de recabar los Factores claves del éxito, internos y externos. Los índices obtenidos en las matrices anteriores, se grafican en la Matriz Interna Externa, la cual consta de 9 cuadrantes.

Matriz de la posición estratégica y evaluación de la acción (PEYEA)

La matriz “PEYEA”, tiene como objetivo determinar cuáles son las estrategias más adecuadas para una organización, una vez definidas sus posiciones estratégicas interna y externa (David, 2003).

Pasos para la construcción de una matriz PEYEA

  1. Seleccionar una serie de variables que incluyan las fuerzas financieras (FF), las ventajas competitivas (VC), la estabilidad del ambiente (EA) y la fuerza de la industria (FI).
  2. Adjudicar un valor numérico de +1 (peor) a +6 (mejor) a cada una de las variables que constituyen las dimensiones FF y FI. Asignar un valor numérico de –1 (mejor) –6 (peor) a cada una de las variables que constituyen las dimensiones VC, EA.
  3. Calcular la calificación promedio de FF, VC, EA, y FI sumando los valores dados a las variables de cada dimensión dividiéndolas entre la cantidad de variables incluidas en la dimensión respectiva.
  4. Anotar las calificaciones promedio de FF, VC, EA, y FI en el eje correspondiente de la matriz PEYEA.
  5. Sumar las dos calificaciones del eje “x” y anotar el punto resultante en X. Sumar las dos calificaciones del eje “y” y anotar el punto resultante en Y. Anotar la intersección del nuevo punto “xy”
  6. Trazar el vector direccional de la matriz PEYEA según el punto de intersección de los ejes. Este vector revelará el tipo de la estrategia recomendable para la organización; agresiva, competitiva, defensiva o conservadora

Matriz de Boston Consuiting Group (BCG)

Es utilizada para realizar el análisis de la posición de un producto/negocio dentro del mercado, o bien de la cartera de negocios de una empresa u organización en el caso de que estos estén diversificados. Gracias a esta herramienta, la empresa elige si es mejor invertir o retirarse del mercado.

Origen de las siglas

Desarrollado en los años 70 Su nombre proveniente de las siglas de Boston Consulting Group (empresa global líder en consultoría estratégica para la alta dirección), también es conocida como matriz de crecimiento o participación, matriz de inversión y brinda ayuda a las empresas a posicionar sus productos o unidades de negocio en el mercado (UEN: Unidades Estratégicas de Negocio). La idea es ayudar a tomar las mejores decisiones a nivel de enfoque de negocios y, sobre todo, de inversiones.

Características

Cuenta con un eje vertical que corresponde al ritmo de crecimiento del mercado y un eje horizontal que ilustra la cuota de participación en el mercado.

Pasos para crear una matriz BCG

  • Identificación de las unidades estratégicas de negocio.
  • Calculo de la dinámica y estructura de ventas para el año seleccionado.
  • Elaboración de la tabla con los datos.
  • Diseño de la matriz para la empresa.
  • Interpretación de datos.
Matriz BCG
Matriz BCG

Matriz de la gran estrategia (MGE)

Esta técnica  brinda conocimiento a lo relacionado sobre la matriz de la gran estrategia, su concepto, utilidad, procedimiento y ejemplo de cómo se debe realizar en una organización para la toma de decisiones en cuanto a la implementación de nuevas estrategias.

Cuadrante I: Cuando una organización se ubica en este cuadrante se encuentra comprometida únicamente con un producto, pero también pueden aprovechar todas las oportunidades externas, corriendo riesgos cuando resulte necesario.  

Cuadrante II: Las empresas que están en un mercado que se caracteriza por un rápido crecimiento, pero enfrentan una posición competitiva débil.  

Cuadrante III: Se encuentran en la parte más vulnerable de la matriz

Cuadrante IV: Se ubican las organizaciones con una posición competitiva fuerte, pero desafortunadamente en un mercado de muy lento crecimiento.

1.3.- Matrices de decisión

Incluye una sola técnica esa es la matriz cuantitativa de la planificación estratégica MCPE. Esta matriz usa la información obtenida de la etapa uno para evaluar las estrategias alternativas viables identificadas ofreciendo una base objetiva para seleccionar estrategias específicas.

Matriz cuantitativa de la planificación estratégica (MCPE)

Esta matriz usa la información obtenida en la etapa uno para evaluar en forma objetiva las estrategias alternativas viables identificadas en la etapa dos. Una MCPE revela el atractivo relativo de estrategias alternativas, y por tanto, ofrece una base objetiva para seleccionar estrategias específicas. La figura siguiente describe el formato básico de la MCPE. La columna izquierda de una MCPE consta de factores clave internos y externos (de los insumos) y la hilera superior consta de estrategias alternativas viables (de la adecuación). Concretamente, la columna de la izquierda de una MCPE consta de información obtenida directamente de la matriz EFE y la matriz EFI. En una columna contigua a los factores críticos para el éxito se registran los pesos respectivos adjudicados a cada uno de los factores de la matriz EFE y la matriz EFI (David, 2003).

La hilera superior de una MCPE consta de las estrategias alternativas derivadas de la matriz DOFA, la matriz PEYEA, la matriz del BCG, la matriz IE y la matriz de la gran estrategia. Estos instrumentos del ajuste suelen generar alternativas viables similares. Sin embargo, no todas las estrategias sugeridas por las técnicas de la adecuación se deben evaluar en una MCPE.

Matriz cuantitativa de la planeación estratégica
Matriz cuantitativa de la planeación estratégica

2.- Diagnostico General

Se determinó a través de la entrevista que se requiere capacitar a los representantes de la comisaria de bienes comunales en relación al desarrollo de proyectos de inversión ya que desconocen sobre cómo realizarlo, sin embargo es importante resaltar que tienen el conocimiento necesario sobre que instituciones pueden apoyarlos a realizar su plan de trabajo, ya que es importante que tengan la consultoría para que futuro ellos mismos puedan ser los que capaciten a los comuneros.

Después de haber analizado la información de la encuesta se detecta que el problema es que los comuneros se encuentran desorientados con respecto a la generación de proyectos y de cómo iniciarlos, contando con pocos conocimientos impiden a estos tener ideas de cómo obtener recursos para que beneficie a su comunidad, ya que requieren de capacitación para el diseño de proyectos.

Esto permite a que la empresa Consultora AGROPROYECTOS le brinde los servicios adecuados y específicos con respecto a las necesidades de los comuneros en  la comisaria de bienes comunales de San Pedro Huamelula a la que pertenece la comunidad del Coyul Huamelula. Proporcionando la capacitación adecuada para que estos obtengan los beneficios.

La mayoría de los encuestados son personas de edades entre los 31 años en adelante 2 mujeres y 15 hombres se detecta que de los comuneros tienen dificultad en determinar el tamaño de que desea producir, así mismo no tienen conocimiento de cómo determinar los lugares de venta de su producto, así como la elaboración de estados contables de factibilidad del proyecto y otros aspectos que se tienen que desarrollar en un proyecto de inversión.

El flujo de información entre ellos es importante puesto que si no todos conocen la información general del proyecto o características, crea confusión sobre, cuestiones de mercadotecnia, y por ende es importante dar inicio con los comuneros desde las actividades básicas del proyecto de inversión proporcionando  información que sea factible y  seguridad para ellos.

A continuación se presenta el desarrollo de las matrices de factores internos y externos que se desarrollaran de acuerdo al diagnóstico final obtenido de la comisaria de bienes comunales de San Pedro Huamelula.

2.1. Matriz de evaluación del factor interno

También denominada Matriz EFI, este instrumento resume y evalúa las fuerzas y debilidades más importantes dentro de las áreas funcionales de un negocio y además ofrece una base para identificar y evaluar las relaciones entre dichas áreas.

  • Debilidades
    • Los comuneros desconoce cómo desarrollar un proyecto
    • Los comuneros tienen un nivel académico bajo
    • Los líderes no están capacitados
    • Existe poca organización entre los representantes y comuneros
  • Fortalezas
    • Conocen todo lo relacionado al campo
    • Saben que tipo de proyecto quieren realizar
    • Los presentantes conocen las instituciones de apoyo al campo
    • Cuentan con el 50% de recursos para el desarrollo de proyectos

“MATRIZ EFI”

Factor interno clave Ponderaciones Clasificación Resultados ponderados
Debilidades
Los     comuneros      desconoce

cómo desarrollar un proyecto

0.092  

0.18

Los comuneros tienen un nivel académico bajo0.102 0.20
Los líderes no están capacitados0.204 0.80
Existe poca organización entre los representantes y

comuneros

0.103 0.30
Fortalezas
Conocen todo lo relacionado al campo0.154 0.60
Saben que tipo de proyecto

quieren realizar

0.204 0.80
Los presentantes conocen las instituciones  de apoyo al campo0..083 0.24
Cuentan con 50% de recursos para el desarrollo de proyectos0..082 0.16
TOTAL MEFI 1  3.28

2.1.1.- Análisis de la matriz

De acuerdo a las normas de calificación para el cálculo del resultado de MEFI, internamente la sociedad de comuneros se encuentra  establemente ya que tienen una puntuación de 3.28, permaneciendo en buen lugar con respecto a sus debilidades internas, la comisaria tiene una variedad de oportunidades para seguir creciendo como organización así mismos superar adversidades y enfrentar nuevos retos.

2.2.- Matriz de evaluación del factor externo (MEFE)

La matriz MEFE es una técnica que permite a los estrategas resumir y evaluar información de los entornos económico, social, cultural, demográfico, ambiental, político, gubernamental, jurídico, tecnológico y competitivo, para ello se realizó una lista de los factores críticos para el éxito.

  • Amenazas
    • Competidores
    • Falta de conocimiento del uso de las TIC´S
    • Manipulación de los recursos por parte de los programas políticos
  • Oportunidades
    • Cercanía del mercado para el desarrollo del proyecto
    • Cuentan con los recursos naturales para desarrolla los proyectos
    • Los apoyos para el campo en el estado son la prioridad

“MATRIZ EFE”

Factor externo clave Ponderaciones Clasificación Resultados ponderados
Amenazas
Competidores0.203   0.60
Manipulación de los recursos por parte de los programas

políticos

0.102 0.20
Falta de conocimiento del uso de las TIC´S0.204 0.80
Oportunidad 
Cercanía del mercado para el desarrollo del proyecto0.102 0.20
Cuentan con los recursos naturales para desarrolla los proyectos0.254 1
El apoyo para el campo en el estado son la prioridad0.153 0.45
TOTAL MEFE 1  3.25

2.2.1.- Análisis de la matriz

El resultado en la aplicación MEFE es de 3.25 siendo la calificación promedio, lo que nos indica que tienen factores externos que apoyan las oportunidades de desarrollar proyectos que beneficien a la economía de la región y el flujo económico de la misma, ya que cuentan con las condiciones idóneas para  poder desarrollar proyectos, cabe mencionar que los comuneros se encuentran  viviendo en una región que es muy apoyada por el gobierno y accesible a los mercados.

2.3.- Análisis FODA de la consultoría

Identificar y observar las Fortalezas, Debilidades, Oportunidades y Amenazas que posee la comisaria de bienes comunales, en los factores internos y externos para así tener mejor nivel en el desarrollo de proyectos.

“Matriz FODA de la Comisaria de Bienes Comunales de San Pedro Huamelula”

Matriz FODA de la Comisaria de Bienes Comunales de San Pedro Huamelula
Matriz FODA de la Comisaria de Bienes Comunales de San Pedro Huamelula

2.3.1.- Análisis de la matriz FODA

A partir de la matriz FODA determinamos que la comisaria de Bienes Comunales de San Pedro Huamelula requiere de la implementación  de estrategias para desarrollar un financiamiento gubernamental del campo, realizar la planeación de un programa de capacitación para el aprendizaje de cómo se debe realizar un proyecto de inversión, así mismo determinar que instituciones pueden apoyar a los comuneros en el desarrollo del mismo.

2.4.- Matriz cuantitativa de la planificación estratégica

Para realizar la matriz cuantitativa se eligieron cinco alternativas, dichas alternativas se obtuvieron la matriz FODA y las alternativas uno, dos, tres, cuatro y cinco, estas opciones servirán para seleccionar la más factible y así generar las estrategias fundamentales para lograr la comercialización del producto de Santa Ana S.A de C.V.

Las alternativas son las siguientes:

  • Alternativa 1: Determinar las instituciones que brindan apoyo al sector económico del campo o agricultor.
  • Alternativa 2: Desarrollar financiamiento  gubernamentales de al campo. Alternativa 3: Planeación de un programa de capacitación para el aprendizaje del desarrollo de proyectos.
  • Alternativa 4: Hacer una revolución de las intuiciones de apoyo al campo en cuestiones de derechos y deberes de los comuneros tomando en cuenta el marco legal para el desarrollo de proyectos.
  • Alternativa 5: Desarrollar cursos enfocado a las nuevas tecnologías (TIC´S).

Matriz cuantitativa de la planificación estratégica

ESTRATEGIAS ALTERNATIVAS
FACTORES CRÍTICOS

PARA EL ÉXITO

Alternativa 1Alternativa 2Alternativa 3Alternativa 4Alternativa 5
PESOCATCACATCACATCACATCA
OPORTUNIDADES40.4
Cercanía del mercado para el desarrollo del proyecto.1040.44140.420.2030.3
Cuentan con los recursos naturales para desarrolla los proyectos0.2530.7540.604130.7530.75
El apoyo para el campo en el estado son la prioridad0.1530.4540.6030.4540.60
AMENAZAS40.80
Competidores0.2030.6030.3040.8030.6020.40
Manipulación de los recursos por parte de los programas políticos0.1020.2030.6030.3020.2020.20
Falta de conocimiento del uso de las TIC´S0.2030.6030.6030.6010.20
FORTALEZAS40.60
Conocen todo lo relacionado al campo0.1530.4540.8040.6030.4530.45
Saben que tipo de proyecto quieren realizar0.2030.6040.3240.8030.6030.60
Los presentantes conocen las

instituciones  de apoyo al campo

0.0840.3240.3240.3240.3220.16
Cuentan con 50% de recursos para el

desarrollo de proyectos

0.0830.2440.3230.2420.16
DEBILIDADES40.36
Los comuneros desconoce cómo desarrollar un proyecto0.0910..0940.4040.3630.2730.27
Los comuneros tienen un nivel académico

bajo

0.1020.2040.8040.4010.1020.20
Los líderes no están capacitados0.2030.6040.4040.8040.8040.80
Existe poca organización entre los representantes y comuneros0.1040.407.40.3040.4040.4040.40
TOTAL5.96.637.45.985.49

2.4.1.- Análisis de la Matriz MPCE

Se escogió la siguiente alternativa por obtener el valor más alto en comparación de las demás alternativas y el cual es el siguiente, Alternativa 3: Planeación de un programa de capacitación para el aprendizaje del desarrollo de proyectos, cabe recalcar que esta estrategia coincide con el diagnostico final ya que el diagnostico arrojo que se debe dar capacitación a los líderes, como a comuneros en el desarrollo de proyectos de inversión ya que desconocen cómo realizarlo.

2.5.- Desarrollo de la alternativa

Alternativa 3: Planeación de un programa de capacitación para el aprendizaje del desarrollo de proyectos.

Se determinó que la comisaria de bienes comunales de San Pedro Huamelula requiere de una capacitación sobre las bases del desarrollo de proyectos de inversión apoyado de diversas vías  de herramientas, las cuales son:

  1. Cronogramas de los tiempos de capacitación: Se determinaran las actividades a realizar en la capacitación y los tiempos en que se llevaran a cabo para los comuneros de la comunidad del Coyul, así como los responsables de cada una de las actividades.
  2. Planeación del presupuesto de los materiales de la capacitación: Se realizara la planeación del presupuesto de los materiales o herramientas que se utilizaran para el aprendizaje de desarrollo de proyectos para los comuneros, se tomara en cuenta la cantidad, el precio y las características.
  3. Elaboración de proyectos: Se trabaja sobre un proyecto colectivo para el beneficio de la comunidad del Coyul, y en él se aplicara el desarrollo de aprendizaje y se trabajara las partes que integra un proyecto de inversión y son los siguientes:
  • Elaboración de protocolo: Describe los objetivos, diseño, metodología y consideraciones tomadas en cuenta para la implementación y organización de una investigación o experimento científico. Incluye el diseño de los procedimientos a ser utilizados para la observación, análisis e interpretación de los resultados. Además de las condiciones básicas para llevar a cabo la investigación descrita, un protocolo proporciona los antecedentes y motivos por los cuales tal investigación está siendo llevada a cabo y define los parámetros bajo los cuales se medirán sus resultados.
  • Estudio de mercado: Es un proceso sistemático de recolección y análisis de datos e información acerca de los clientes, competidores y el mercado. Sus usos incluyen ayudar a crear un plan de negocios, lanzar un nuevo producto o servicio, mejorar productos o servicios existentes y expandirse a nuevos mercados. El estudio de mercado puede ser utilizado para determinar que porción de la población comprara un producto o servicio, basado en variables como el género, la edad, ubicación y nivel de ingresos.
  • Estudio técnico: Consiste simplemente en hacer un análisis del proceso de producción de un producto o servicio para la realización de un proyecto de inversión.
  • Estudio económico: se encarga de realizar las evaluaciones económicas de cualquier proyecto de inversión, para determinar la factibilidad o viabilidad económica de un proyecto. Este debe estar concebido desde el punto de vista técnico y debe cumplir con los objetivos que de ella se espera
  • Elaboración de las corridas financiera: es una proyección futura de los ingresos y egresos de un proyecto o un negocio. Generalmente se proyecta a 5 años, y contienen una serie de diversas variables a considerar en el proyecto. Realizar una corrida financiera va a depender del nivel de conocimiento que tenga el emprendedor para poder plasmar en una base de datos la innumerable cantidad de variables que desee conocer. Las recomendaciones más importantes dentro de las variables a conocer son: o El retorno de inversión.
  • La tasa de descuento (que es el rendimiento deseado o esperado) o La estructura de costos.

Hazle saber al autor que aprecias su trabajo

1+
Tu opinión vale, comenta aquí

Comentarios

Compártelo con tu mundo

Cita esta página
Blanco Ana Lilia. (2016, mayo 9). Matrices estratégicas de la Comisaría de Bienes Comunales de San Pedro Huamelula México. Recuperado de https://www.gestiopolis.com/matrices-estrategicas-la-comisaria-bienes-comunales-san-pedro-huamelula-mexico/
Blanco, Ana Lilia. "Matrices estratégicas de la Comisaría de Bienes Comunales de San Pedro Huamelula México". GestioPolis. 9 mayo 2016. Web. <https://www.gestiopolis.com/matrices-estrategicas-la-comisaria-bienes-comunales-san-pedro-huamelula-mexico/>.
Blanco, Ana Lilia. "Matrices estratégicas de la Comisaría de Bienes Comunales de San Pedro Huamelula México". GestioPolis. mayo 9, 2016. Consultado el 17 de Octubre de 2019. https://www.gestiopolis.com/matrices-estrategicas-la-comisaria-bienes-comunales-san-pedro-huamelula-mexico/.
Blanco, Ana Lilia. Matrices estratégicas de la Comisaría de Bienes Comunales de San Pedro Huamelula México [en línea]. <https://www.gestiopolis.com/matrices-estrategicas-la-comisaria-bienes-comunales-san-pedro-huamelula-mexico/> [Citado el 17 de Octubre de 2019].
Copiar
Imagen del encabezado cortesía de normanbleventhalmapcenter en Flickr